Review



revertra ace qpcr rt master mix with gdna remover  (Toyobo)


Bioz Verified Symbol Toyobo is a verified supplier
Bioz Manufacturer Symbol Toyobo manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Toyobo revertra ace qpcr rt master mix with gdna remover
    Revertra Ace Qpcr Rt Master Mix With Gdna Remover, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 12912 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gdna+remover/ReverTra+Ace+qPCR+RT+Master+Mix+with+gDNA+Remover/custom%40fsq-301%4042272259
    Average 99 stars, based on 12912 article reviews
    revertra ace qpcr rt master mix with gdna remover - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: A pathogen-induced translational shift enhances plant disease resistance without obvious fitness costs
    Article Snippet: Total RNA was extracted from A . thaliana leaf tissues using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. .. First strand synthesis was performed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO). .. Real-time PCR was conducted by using SYBR Green I Master (Roche) according to the manufacturer's instructions.

    Article Title: Prevention of Vibrio parahaemolyticus infection in pacific white shrimp ( Penaeus vannamei ) using oral Moringa oleifera leaf powder as an alternative to antibiotics
    Article Snippet: Shrimp RNA was extracted from the hepatopancreas using GeneZolTM (Geneaid, Taiwan) following the manufacturer’s instructions. .. Total RNA was analyzed with a Nanodrop 2000 (Thermo Scientific, USA) at 260 nm and 280 nm. cDNA synthesis was performed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) for bacterial RNA and ReverTraAce® qPCR RT Mastermix with gDNA Remover (Toyobo, Japan) for shrimp RNA. ..

    Article Title: Epithelial Glutamate Retention Protects against Colitis
    Article Snippet: According to the manufacturer’s instructions, total RNA samples were prepared from colon using ISOGEN (Nippon Gene, 311-02501) or ReliaPrepTM RNA Miniprep Systems (Promega, Z6011). .. First-strand cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, FSQ-301). .. Real-time PCR was conducted on an Applied Biosystems 7300 Real-Time PCR System (7300 M, Thermo Fisher Scientific) using THUNDERBIRD® Probe qPCR Mix (#QPS-101, TOYOBO). β-Actin was employed for normalization.

    Article Title: Identification of gradual aging and late-onset aging markers using male African turquoise killifish.
    Article Snippet: Total RNA was extracted using TRIzol (Thermo Fisher Scientific, 15596018) from the liver. .. AR TIC LE IN PR ES S cDNA synthesis was performed from 0.6 μg RNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, FSQ-301). .. PCR reaction was performed using SYBR Green qPCR Master Mix (Thermos Scientific, A66732S) on a CFX96 (Bio-Rad) with 95°C (120 s), 40 cycles of 95°C (15 s) and 60°C (60 s).

    Article Title: Presynaptic computation of reward intensities through the dual autoreceptor system.
    Article Snippet: RNA concentrations were measured by NanoDrop (Thermo Fisher Scientific) and adjusted ll OPEN ACCESS Current Biology 36, 1–10.e1–e4, May 4, 2026 e3 Article to equivalent levels. .. Reverse transcription was carried out using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, FSQ-301) to synthesize cDNA. qRT-PCR was conducted with TB Green Premix Ex Taq II Fast qPCR (Takara Bio) using a CFX96 Touch Real-Time PCR system (Bio-Rad). ..

    Article Title: Discovery of novel
    Article Snippet: Total RNA of A. muciniphila was extracted using Trizol (Thermo Fisher Scientific). .. For cDNA synthesis using bacterial RNA, a gDNA remover (Toyobo) and the ReverTra Ace qPCR RT Master Mix were used. cDNA was used as a template for real-time PCR performed using SYBR green chemistry (Affymetrix) on a Real-time PCR system (Applied Biosystems). ..

    Article Title: Structural diversity of isoprene synthases in mosses from multiple terpenoid synthase lineages
    Article Snippet: .. Total RNA was extracted from the frozen samples using RNAiso Plus (Takara Bio) and reverse-transcribed into cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO) following the manufacturer's protocols. .. For the quantitative RT–PCR experiment, each target was amplified using THUNDERBIRD Next SYBR qPCR Mix (TOYOBO) and detected using a QuantStudio 1 Real-Time PCR System (Applied Biosystems).

    Article Title: Method for direct transdifferentiation of somatic cell
    Article Snippet: .. TABLE 1A Name Animal of Species Cell Type gene Fw Human Neuronal AscI1 CACTGATTTTGCTGCTGCTTCT (SEQ ID NO: 3) cell Brn2 GCAAAAGGAAAGCAACTAAGAC (SEQ ID NO: 5) Myt1I TTGTTAAACCTCGGCAAAATCG (SEQ ID NO: 7) TUBB3 GGCCAAGTTCTGGGAAGTCA (SEQ ID NO: 9) Adipocyte PPARγ TCTCAAACGAGAGTCAGCCTTT (SEQ ID NO: 11) FABP4 TACTGGGCCAGGAATTTGAC (SEQ ID NO: 13) Osteocyte ALP CATGCTGAGTGACACAGACAAGAAG (SEQ ID NO: 15) BGLAP CCTCACACTCCTCGCCCTAT (SEQ ID NO: 17) House- GAPDH ATGTTCGTCATGGGTGTGAA keeping (SEQ ID NO: 19) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd.) Reagent for Q-PCR: THUNDERBIRD® SYBR qPCR Mix (Toyobo Co., Ltd.) Device for Q-PCR: QuantStudio® 5 real-time PCR system TABLE 1B Name Animal Cell of Species Type gene Rv Human Neuronal AscI1 TGGCGCTCGCGTGTG (SEQ ID NO: 4) cell Brn2 CCATCTCTCTGTCTCTCTCTC (SEQ ID NO: 6) Myt1I AGACTATTGGAGGTATTGCTGTT CATT (SEQ ID NO: 8) TUBB3 CGAGTCGCCCACGTAGTTG (SEQ ID NO: 10) Adipocyte PPARγ GCAGGCTCCACTTTGATTGC (SEQ ID NO: 12) FABP4 GTGGAAGTGACGCCTTTCAT (SEQ ID NO: 14) Osteocyte ALP TGGTAGTTGTTGTGAGCATAGTCCA (SEQ ID NO: 16) BGLAP TGCTTGGACACAAAGGCTGC (SEQ ID NO: 18) House- GAPDH TGTGGTCATGAGTCCTTCCA keeping (SEQ ID NO: 20) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd.) Reagent for Q-PCR: THUNDERBIRD® SYBR qPCR Mix (Toyobo Co., Ltd.) Device for Q-PCR: QuantStudio® 5 real-time PCR system FIG. 5 shows an effect of direct transdifferentiation into neuronal cells using GLIS1. ..

    cDNA Synthesis:

    Article Title: Prevention of Vibrio parahaemolyticus infection in pacific white shrimp ( Penaeus vannamei ) using oral Moringa oleifera leaf powder as an alternative to antibiotics
    Article Snippet: Shrimp RNA was extracted from the hepatopancreas using GeneZolTM (Geneaid, Taiwan) following the manufacturer’s instructions. .. Total RNA was analyzed with a Nanodrop 2000 (Thermo Scientific, USA) at 260 nm and 280 nm. cDNA synthesis was performed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) for bacterial RNA and ReverTraAce® qPCR RT Mastermix with gDNA Remover (Toyobo, Japan) for shrimp RNA. ..

    Article Title: Identification of gradual aging and late-onset aging markers using male African turquoise killifish.
    Article Snippet: Total RNA was extracted using TRIzol (Thermo Fisher Scientific, 15596018) from the liver. .. AR TIC LE IN PR ES S cDNA synthesis was performed from 0.6 μg RNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, FSQ-301). .. PCR reaction was performed using SYBR Green qPCR Master Mix (Thermos Scientific, A66732S) on a CFX96 (Bio-Rad) with 95°C (120 s), 40 cycles of 95°C (15 s) and 60°C (60 s).

    Article Title: Discovery of novel
    Article Snippet: Total RNA of A. muciniphila was extracted using Trizol (Thermo Fisher Scientific). .. For cDNA synthesis using bacterial RNA, a gDNA remover (Toyobo) and the ReverTra Ace qPCR RT Master Mix were used. cDNA was used as a template for real-time PCR performed using SYBR green chemistry (Affymetrix) on a Real-time PCR system (Applied Biosystems). ..

    Article Title: Method for direct transdifferentiation of somatic cell
    Article Snippet: .. TABLE 1A Name Animal of Species Cell Type gene Fw Human Neuronal AscI1 CACTGATTTTGCTGCTGCTTCT (SEQ ID NO: 3) cell Brn2 GCAAAAGGAAAGCAACTAAGAC (SEQ ID NO: 5) Myt1I TTGTTAAACCTCGGCAAAATCG (SEQ ID NO: 7) TUBB3 GGCCAAGTTCTGGGAAGTCA (SEQ ID NO: 9) Adipocyte PPARγ TCTCAAACGAGAGTCAGCCTTT (SEQ ID NO: 11) FABP4 TACTGGGCCAGGAATTTGAC (SEQ ID NO: 13) Osteocyte ALP CATGCTGAGTGACACAGACAAGAAG (SEQ ID NO: 15) BGLAP CCTCACACTCCTCGCCCTAT (SEQ ID NO: 17) House- GAPDH ATGTTCGTCATGGGTGTGAA keeping (SEQ ID NO: 19) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd.) Reagent for Q-PCR: THUNDERBIRD® SYBR qPCR Mix (Toyobo Co., Ltd.) Device for Q-PCR: QuantStudio® 5 real-time PCR system TABLE 1B Name Animal Cell of Species Type gene Rv Human Neuronal AscI1 TGGCGCTCGCGTGTG (SEQ ID NO: 4) cell Brn2 CCATCTCTCTGTCTCTCTCTC (SEQ ID NO: 6) Myt1I AGACTATTGGAGGTATTGCTGTT CATT (SEQ ID NO: 8) TUBB3 CGAGTCGCCCACGTAGTTG (SEQ ID NO: 10) Adipocyte PPARγ GCAGGCTCCACTTTGATTGC (SEQ ID NO: 12) FABP4 GTGGAAGTGACGCCTTTCAT (SEQ ID NO: 14) Osteocyte ALP TGGTAGTTGTTGTGAGCATAGTCCA (SEQ ID NO: 16) BGLAP TGCTTGGACACAAAGGCTGC (SEQ ID NO: 18) House- GAPDH TGTGGTCATGAGTCCTTCCA keeping (SEQ ID NO: 20) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd.) Reagent for Q-PCR: THUNDERBIRD® SYBR qPCR Mix (Toyobo Co., Ltd.) Device for Q-PCR: QuantStudio® 5 real-time PCR system FIG. 5 shows an effect of direct transdifferentiation into neuronal cells using GLIS1. ..

    Synthesized:

    Article Title: Epithelial Glutamate Retention Protects against Colitis
    Article Snippet: According to the manufacturer’s instructions, total RNA samples were prepared from colon using ISOGEN (Nippon Gene, 311-02501) or ReliaPrepTM RNA Miniprep Systems (Promega, Z6011). .. First-strand cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, FSQ-301). .. Real-time PCR was conducted on an Applied Biosystems 7300 Real-Time PCR System (7300 M, Thermo Fisher Scientific) using THUNDERBIRD® Probe qPCR Mix (#QPS-101, TOYOBO). β-Actin was employed for normalization.

    Reverse Transcription:

    Article Title: Presynaptic computation of reward intensities through the dual autoreceptor system.
    Article Snippet: RNA concentrations were measured by NanoDrop (Thermo Fisher Scientific) and adjusted ll OPEN ACCESS Current Biology 36, 1–10.e1–e4, May 4, 2026 e3 Article to equivalent levels. .. Reverse transcription was carried out using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, FSQ-301) to synthesize cDNA. qRT-PCR was conducted with TB Green Premix Ex Taq II Fast qPCR (Takara Bio) using a CFX96 Touch Real-Time PCR system (Bio-Rad). ..

    Article Title: Structural diversity of isoprene synthases in mosses from multiple terpenoid synthase lineages
    Article Snippet: .. Total RNA was extracted from the frozen samples using RNAiso Plus (Takara Bio) and reverse-transcribed into cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO) following the manufacturer's protocols. .. For the quantitative RT–PCR experiment, each target was amplified using THUNDERBIRD Next SYBR qPCR Mix (TOYOBO) and detected using a QuantStudio 1 Real-Time PCR System (Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: Presynaptic computation of reward intensities through the dual autoreceptor system.
    Article Snippet: RNA concentrations were measured by NanoDrop (Thermo Fisher Scientific) and adjusted ll OPEN ACCESS Current Biology 36, 1–10.e1–e4, May 4, 2026 e3 Article to equivalent levels. .. Reverse transcription was carried out using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, FSQ-301) to synthesize cDNA. qRT-PCR was conducted with TB Green Premix Ex Taq II Fast qPCR (Takara Bio) using a CFX96 Touch Real-Time PCR system (Bio-Rad). ..

    SYBR Green Assay:

    Article Title: Discovery of novel
    Article Snippet: Total RNA of A. muciniphila was extracted using Trizol (Thermo Fisher Scientific). .. For cDNA synthesis using bacterial RNA, a gDNA remover (Toyobo) and the ReverTra Ace qPCR RT Master Mix were used. cDNA was used as a template for real-time PCR performed using SYBR green chemistry (Affymetrix) on a Real-time PCR system (Applied Biosystems). ..

    RNA Extraction:

    Article Title: Method for direct transdifferentiation of somatic cell
    Article Snippet: .. TABLE 1A Name Animal of Species Cell Type gene Fw Human Neuronal AscI1 CACTGATTTTGCTGCTGCTTCT (SEQ ID NO: 3) cell Brn2 GCAAAAGGAAAGCAACTAAGAC (SEQ ID NO: 5) Myt1I TTGTTAAACCTCGGCAAAATCG (SEQ ID NO: 7) TUBB3 GGCCAAGTTCTGGGAAGTCA (SEQ ID NO: 9) Adipocyte PPARγ TCTCAAACGAGAGTCAGCCTTT (SEQ ID NO: 11) FABP4 TACTGGGCCAGGAATTTGAC (SEQ ID NO: 13) Osteocyte ALP CATGCTGAGTGACACAGACAAGAAG (SEQ ID NO: 15) BGLAP CCTCACACTCCTCGCCCTAT (SEQ ID NO: 17) House- GAPDH ATGTTCGTCATGGGTGTGAA keeping (SEQ ID NO: 19) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd.) Reagent for Q-PCR: THUNDERBIRD® SYBR qPCR Mix (Toyobo Co., Ltd.) Device for Q-PCR: QuantStudio® 5 real-time PCR system TABLE 1B Name Animal Cell of Species Type gene Rv Human Neuronal AscI1 TGGCGCTCGCGTGTG (SEQ ID NO: 4) cell Brn2 CCATCTCTCTGTCTCTCTCTC (SEQ ID NO: 6) Myt1I AGACTATTGGAGGTATTGCTGTT CATT (SEQ ID NO: 8) TUBB3 CGAGTCGCCCACGTAGTTG (SEQ ID NO: 10) Adipocyte PPARγ GCAGGCTCCACTTTGATTGC (SEQ ID NO: 12) FABP4 GTGGAAGTGACGCCTTTCAT (SEQ ID NO: 14) Osteocyte ALP TGGTAGTTGTTGTGAGCATAGTCCA (SEQ ID NO: 16) BGLAP TGCTTGGACACAAAGGCTGC (SEQ ID NO: 18) House- GAPDH TGTGGTCATGAGTCCTTCCA keeping (SEQ ID NO: 20) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd.) Reagent for Q-PCR: THUNDERBIRD® SYBR qPCR Mix (Toyobo Co., Ltd.) Device for Q-PCR: QuantStudio® 5 real-time PCR system FIG. 5 shows an effect of direct transdifferentiation into neuronal cells using GLIS1. ..



    Similar Products

    99
    Toyobo revertra ace qpcr rt master mix with gdna remover
    Revertra Ace Qpcr Rt Master Mix With Gdna Remover, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gdna+remover/ReverTra+Ace+qPCR+RT+Master+Mix+with+gDNA+Remover/custom%40fsq-301%4042272259
    Average 99 stars, based on 1 article reviews
    revertra ace qpcr rt master mix with gdna remover - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    Image Search Results