revertra ace qpcr rt master mix with gdna remover (Toyobo)
99
Structured Review
Toyobo
revertra ace qpcr rt master mix with gdna remover
Revertra Ace Qpcr Rt Master Mix With Gdna Remover, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 12912 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gdna+remover/ReverTra+Ace+qPCR+RT+Master+Mix+with+gDNA+Remover/custom%40fsq-301%4042272259
Average 99 stars, based on 12912 article reviews
Revertra Ace Qpcr Rt Master Mix With Gdna Remover, supplied by Toyobo, used in various techniques. Bioz Stars score: 99/100, based on 12912 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gdna+remover/ReverTra+Ace+qPCR+RT+Master+Mix+with+gDNA+Remover/custom%40fsq-301%4042272259
Average 99 stars, based on 12912 article reviews
revertra ace qpcr rt master mix with gdna remover - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Real-time Polymerase Chain Reaction:Article Title: A pathogen-induced translational shift enhances plant disease resistance without obvious fitness costs Article Snippet: Total RNA was extracted from A . thaliana leaf tissues using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. .. First strand synthesis was performed using ReverTra Ace qPCR RT Master Mix with Article Title: Prevention of Vibrio parahaemolyticus infection in pacific white shrimp ( Penaeus vannamei ) using oral Moringa oleifera leaf powder as an alternative to antibiotics Article Snippet: Shrimp RNA was extracted from the hepatopancreas using GeneZolTM (Geneaid, Taiwan) following the manufacturer’s instructions. .. Total RNA was analyzed with a Nanodrop 2000 (Thermo Scientific, USA) at 260 nm and 280 nm. cDNA synthesis was performed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) for bacterial RNA and ReverTraAce® qPCR RT Mastermix with Article Title: Epithelial Glutamate Retention Protects against Colitis Article Snippet: According to the manufacturer’s instructions, total RNA samples were prepared from colon using ISOGEN (Nippon Gene, 311-02501) or ReliaPrepTM RNA Miniprep Systems (Promega, Z6011). .. First-strand cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with Article Title: Identification of gradual aging and late-onset aging markers using male African turquoise killifish. Article Snippet: Total RNA was extracted using TRIzol (Thermo Fisher Scientific, 15596018) from the liver. .. AR TIC LE IN PR ES S cDNA synthesis was performed from 0.6 μg RNA using ReverTra Ace qPCR RT Master Mix with Article Title: Presynaptic computation of reward intensities through the dual autoreceptor system. Article Snippet: RNA concentrations were measured by NanoDrop (Thermo Fisher Scientific) and adjusted ll OPEN ACCESS Current Biology 36, 1–10.e1–e4, May 4, 2026 e3 Article to equivalent levels. .. Reverse transcription was carried out using ReverTra Ace qPCR RT Master Mix with Article Title: Discovery of novel Article Snippet: Total RNA of A. muciniphila was extracted using Trizol (Thermo Fisher Scientific). .. For cDNA synthesis using bacterial RNA, a Article Title: Structural diversity of isoprene synthases in mosses from multiple terpenoid synthase lineages Article Snippet: .. Total RNA was extracted from the frozen samples using RNAiso Plus (Takara Bio) and reverse-transcribed into cDNA using ReverTra Ace qPCR RT Master Mix with Article Title: Method for direct transdifferentiation of somatic cell Article Snippet: .. TABLE 1A Name Animal of Species Cell Type gene Fw Human Neuronal AscI1 CACTGATTTTGCTGCTGCTTCT (SEQ ID NO: 3) cell Brn2 GCAAAAGGAAAGCAACTAAGAC (SEQ ID NO: 5) Myt1I TTGTTAAACCTCGGCAAAATCG (SEQ ID NO: 7) TUBB3 GGCCAAGTTCTGGGAAGTCA (SEQ ID NO: 9) Adipocyte PPARγ TCTCAAACGAGAGTCAGCCTTT (SEQ ID NO: 11) FABP4 TACTGGGCCAGGAATTTGAC (SEQ ID NO: 13) Osteocyte ALP CATGCTGAGTGACACAGACAAGAAG (SEQ ID NO: 15) BGLAP CCTCACACTCCTCGCCCTAT (SEQ ID NO: 17) House- GAPDH ATGTTCGTCATGGGTGTGAA keeping (SEQ ID NO: 19) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with cDNA Synthesis:Article Title: Prevention of Vibrio parahaemolyticus infection in pacific white shrimp ( Penaeus vannamei ) using oral Moringa oleifera leaf powder as an alternative to antibiotics Article Snippet: Shrimp RNA was extracted from the hepatopancreas using GeneZolTM (Geneaid, Taiwan) following the manufacturer’s instructions. .. Total RNA was analyzed with a Nanodrop 2000 (Thermo Scientific, USA) at 260 nm and 280 nm. cDNA synthesis was performed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA) for bacterial RNA and ReverTraAce® qPCR RT Mastermix with Article Title: Identification of gradual aging and late-onset aging markers using male African turquoise killifish. Article Snippet: Total RNA was extracted using TRIzol (Thermo Fisher Scientific, 15596018) from the liver. .. AR TIC LE IN PR ES S cDNA synthesis was performed from 0.6 μg RNA using ReverTra Ace qPCR RT Master Mix with Article Title: Discovery of novel Article Snippet: Total RNA of A. muciniphila was extracted using Trizol (Thermo Fisher Scientific). .. For cDNA synthesis using bacterial RNA, a Article Title: Method for direct transdifferentiation of somatic cell Article Snippet: .. TABLE 1A Name Animal of Species Cell Type gene Fw Human Neuronal AscI1 CACTGATTTTGCTGCTGCTTCT (SEQ ID NO: 3) cell Brn2 GCAAAAGGAAAGCAACTAAGAC (SEQ ID NO: 5) Myt1I TTGTTAAACCTCGGCAAAATCG (SEQ ID NO: 7) TUBB3 GGCCAAGTTCTGGGAAGTCA (SEQ ID NO: 9) Adipocyte PPARγ TCTCAAACGAGAGTCAGCCTTT (SEQ ID NO: 11) FABP4 TACTGGGCCAGGAATTTGAC (SEQ ID NO: 13) Osteocyte ALP CATGCTGAGTGACACAGACAAGAAG (SEQ ID NO: 15) BGLAP CCTCACACTCCTCGCCCTAT (SEQ ID NO: 17) House- GAPDH ATGTTCGTCATGGGTGTGAA keeping (SEQ ID NO: 19) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with Synthesized:Article Title: Epithelial Glutamate Retention Protects against Colitis Article Snippet: According to the manufacturer’s instructions, total RNA samples were prepared from colon using ISOGEN (Nippon Gene, 311-02501) or ReliaPrepTM RNA Miniprep Systems (Promega, Z6011). .. First-strand cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with Reverse Transcription:Article Title: Presynaptic computation of reward intensities through the dual autoreceptor system. Article Snippet: RNA concentrations were measured by NanoDrop (Thermo Fisher Scientific) and adjusted ll OPEN ACCESS Current Biology 36, 1–10.e1–e4, May 4, 2026 e3 Article to equivalent levels. .. Reverse transcription was carried out using ReverTra Ace qPCR RT Master Mix with Article Title: Structural diversity of isoprene synthases in mosses from multiple terpenoid synthase lineages Article Snippet: .. Total RNA was extracted from the frozen samples using RNAiso Plus (Takara Bio) and reverse-transcribed into cDNA using ReverTra Ace qPCR RT Master Mix with Quantitative RT-PCR:Article Title: Presynaptic computation of reward intensities through the dual autoreceptor system. Article Snippet: RNA concentrations were measured by NanoDrop (Thermo Fisher Scientific) and adjusted ll OPEN ACCESS Current Biology 36, 1–10.e1–e4, May 4, 2026 e3 Article to equivalent levels. .. Reverse transcription was carried out using ReverTra Ace qPCR RT Master Mix with SYBR Green Assay:Article Title: Discovery of novel Article Snippet: Total RNA of A. muciniphila was extracted using Trizol (Thermo Fisher Scientific). .. For cDNA synthesis using bacterial RNA, a RNA Extraction:Article Title: Method for direct transdifferentiation of somatic cell Article Snippet: .. TABLE 1A Name Animal of Species Cell Type gene Fw Human Neuronal AscI1 CACTGATTTTGCTGCTGCTTCT (SEQ ID NO: 3) cell Brn2 GCAAAAGGAAAGCAACTAAGAC (SEQ ID NO: 5) Myt1I TTGTTAAACCTCGGCAAAATCG (SEQ ID NO: 7) TUBB3 GGCCAAGTTCTGGGAAGTCA (SEQ ID NO: 9) Adipocyte PPARγ TCTCAAACGAGAGTCAGCCTTT (SEQ ID NO: 11) FABP4 TACTGGGCCAGGAATTTGAC (SEQ ID NO: 13) Osteocyte ALP CATGCTGAGTGACACAGACAAGAAG (SEQ ID NO: 15) BGLAP CCTCACACTCCTCGCCCTAT (SEQ ID NO: 17) House- GAPDH ATGTTCGTCATGGGTGTGAA keeping (SEQ ID NO: 19) Total RNA Extraction: TRIREAGENT (Cosmo Bio Co., Ltd.) 800 μl/1 well cDNA synthesis: ReverTra Ace® qPCR RT Master Mix with |